TABLE 3.

Primers and control strains used in PCR experiments

Target geneForward and reverse primers (5′-3′)Amplimer size (bp)Control strainReference
tet(M)GTGGAGTACTACATTTACGAG359Enterococcus faecalis BM4110::Tn154521
GAAGCGGATCACTATCTGAG
tet(O)GCGGAACATTGCATTTGAGGG538Streptococcus anginosus MG237
CTCTATGGACAACCCGACAGAAG
tet(S)CGCTACATTTGCGAGACTCAG569Listeria monocytogenes BM4210/pIP81123
GGCTCTCATACTGAATGCCAC
tet(T)CAGTGGGAATATAAGGACACGTC644Streptococcus pyogenes A4987
CAAGCCTTCTCTACAGCATC
tet(K)GTAGGATCTGCTGCATTCCC552Staphylococcus aureus RN4220/pT18116
CACTATTACCTATTGTCGC
tet(L)GGATCGATAGTAGCCATGGG516Listeria monocytogenes BM4212/pIP81223
GTATCCCACCAATGTAGCCG
int-TnGATGGTATTGATGTTGTAGG528Enterococcus faecalis BM4110::Tn154521
GGTCTATATTGACAAGACG
erm(B)GGTAAAGGGCATTTAACGAC454Enterococcus faecalis BM4110::Tn154521
CGATATTCTCGATTGACCCA
erm(A/TR)TCAGGAAAAGGACATTTTACC423Streptococcus agalactiae NEMLJ12This work
ATACTTTTTGTAGTCCTTCTT
erm(C)TCAAAACATAATATAGATAAA649Staphylococcus aureus RN4220/pE19414
GCTAATATTGTTTAAATCGTCAAT
mef(A)AGTATCATTAATCACTAGTGC328Streptococcus agalactiae NEMLJ20This work
TTCTTCTGGTACTAAAAGTGG
mreAAGACACCTCGTCTAACCTTC498Streptococcus agalactiae NEM3165
TCTGCAGGTAAGTAAGTGCG
aphA3GGGGTACCTTTAAATACTGTAG848Enterococcus faecalis BM4110::Tn154521
TCTGGATCCTAAAACAATTCATCC
aad-6AGAAGATGTAATAATATAG978Listeria monocytogenes BM4210/pIP81123
CTGTAATCACTGTTCCCGCCT