TABLE 2.

PCR primers used in this study

AmpliconPrimer sequence (5′ - 3′)Size of amplicon (bp)Reference
vanBCAAAGCTCCGCAGCTTGCATG4846
TGCATCCAAGCACCCGATATAC
vanB longGTTTGATGCAGAGGCAGACGACT5,9596
ACAAGTTCCCCTGTATCCAAGTGG
Tn5382GTTCTTATTCCGCAGGTGGTGATT3114
ACGCCATGCTATTTACTTCCGGC
Tn5382 left inverseGCTATGGCAGTTTTCCGTGTGVariableThis study
TCGCCTCCTTTCTCTATTTGG
Tn5382 right inverseGAGGGGGAAATGGTGAGAGGTVariableThis study
AACGCTTCTTCATGGCTCTTG
TUH2-18 Tn5382 leftTACTGCCAATGATGTCAACCC721This study
GTTCTTATTCCGCAGGTGGTGATT
TUH2-18 Tn5382 rightGAGGGGGAAATGGTGAGAGGT413This study
ATCCTTTGACGATCATCTTGG
TUH2-18 Tn5382 targetTACTGCCAATGATGTCAACCC439This study
ATCCTTTGACGATCATCTTGG
TUH2-19 Tn5382 leftCCGCAAGGGGATTTTAGTA677This study
GTTCTTATTCCGCAGGTGGTGATT
TUH2-19 Tn5382 rightGAGGGGGAAATGGTGAGAGGT248This study
CCACGGCTACAATAATCACA
TUH2-19 Tn5382 targetCCGCAAGGGGATTTTAGTA224This study
CCACGGCTACAATAATCACA
Tn5382-like junctionGAGGGGGAAATGGTGAGAGGT701aThis study
GTTCTTATTCCGCAGGTGGTGATT
IS1216VAAAGCAATTTCAGCAGGATG456This study
GTACGATGTTCTGTCCCTTG
16S rDNATGCATTAGCTAGTTGGTGAGG7267
TCGAATTAAACCACATGCTCC
23S rDNACGCATGTACAGGATAGGTAGG669This study
AGGTGGGCTTCACACTTAGAT
  • a Including 6-bp coupling sequence.