TABLE 2.

PCR primers used in this study

Primer and purposeSequence (5′ to 3′)Target gene or descriptionAmplicon size (bp)Reference, accession no., and/or chromosomal locationd
Class 1 integron and cassette detection
    In-FGGCATCCAAGCAGCAAGClass 1 integronVariable23
    In-BAAGCAGACTTGACCTGA
    Dfr-BaTCACCTTCTGGCTCAATGTCGdfrA15490Z83311, bp 374-354
    Aad-BaGCCGACTACCTTGGTGATCTCGaadA11,476AY103457, bp 786-765
    blaP1-BaCTGGTTCATTTCAGATAGCGblaP187411
Integron cluster mapping and characterization
    3′CSrevAGTCCAGTTCAGACGAAIntegron spacersVariableU12338, bp 1433-1416
    5′CSrevGAACGACGAACCTACGGU12338, bp 4814-4831
    Dfr-FbGGAGTTATCGGAAATGGCCCAGIntegron spacersVariableZ83311, bp 37-58
    Bla-FbGGCAATCAGCGCTTCCCGTTAF221899, bp 334-353
    Dfr-F2TTAGCCAAGACTTCGTGTdfrA15-sul1AB113114, bp 515-532
    Sul1BGCAAGGCGGAAACCCGCGCCX12869, bp 1360-1341
    Int1AAAAACCGCCACTGCGCCGTTAintI11,20012
    Int1BGAAGACGGCTGCACTGAACG
    Sul1AcGCACGTGCTGTCGAACCTTCAAY0462763, bp 38844-38865
    Aph FGGCAATCAGGTGCGACAATkan484AY090559, bp 12978-12997
    Aph RGTGACGACTGAATCCGGTGAAY090559, bp 13461-13441
    CAT1-FGGCATTTCAGTCAGTTGcat1584V00622, bp 312-328
    CAT1-BCCGCCCTGCCACTCATCV00622, bp 880-896
    TET(G) 1GCTCGGTGGTATCTCTGCTCtetG46825
    TET(G) 2AGCAACAGAATCGGGAACAC
ICE detection and characterization
    Int1-FGCTGGATAGGTTAAGGGCGGSXT int5928
    Int1-BCTCTATGGGCACTGTCCACATTG
    Nint-FTACCTACAGCAGGAACGGGCSXT int258AF099172, bp 255-274
    Nint-BGCAGCACAGACACCAGACGTAF099172, bp 513-494
    FLOR-FTTATCTCCCTGTCGTTCCAGCGfloR52622
    FLOR-2CCTATGAGCACACGGGGAGC
    TMP-FTGGGTAAGACACTCGTCATGGGdfr1838919
    TMP-BACTGCCGTTTTCGATAATGTGG
    SUL2-FAGGGGGCAGATGTGATCGCsul2625AY034138, bp 16726-16706
    SUL2-BTGTGCGGATGAAGTCAGCTCC19
    STRA-FTTGATGTGGTGTCCCGCAATGCstrA38319
    STRA-BCCAATCGCAGATAGAAGGCAA
    strB-FGGCACCCATAAGCGTACGCCstrB47010
    strB-RTGCCGAGCACGGCGACTACC
    dfr1-FCGAAGAATGGAGTTATCGGGdfrA137222
    dfr1-BTGCTGGGGATTTCAGGAAAG
  • a Paired with In-F.

  • b Paired by different primer pair combination for mapping the integron cluster (see the text).

  • c To be paired with 5′CSrev.

  • d Primers without references were newly designed.