TABLE 2.

Primers used in this study

PrimerExptNucleotide sequence (5′-3′)LocationSource or reference
ORF513D3PCRCTCACGCCCTGGCAAGGTTTorf5135
ORF513D5PCRCTTTTGCCCTAGCTGCGGTorf5135
QnrAPCRGGGTATGGATATTATTGATAAAGqnrA9
QnrBPCRCTAATCCGGCAGCACTATTAqnrA9
Pre-qnrA1PCRCGGCAGTTAAAATTGGGGCTUpstream of qnrAThis study
Pre-qnrA2PCRGAGGGAATTTCAGGTAAGATACUpstream of qnrAThis study
CTX-MA1PCRSCSATGTGCAGYACCAGTAAblaCTX-M4
CTX-MA2PCRCCGCRATATGRTTGGTGGTGblaCTX-M4
dfrBPCRATGCGCAGCATTTGGGTGTCdfrThis study
dfrFPCRGTTATGGAGCAGCAACGATGdfrThis study
GSP1-qnrA5′-RACEAAGTACATCTTATGGCTGACTTGAqnrA5
GSP2-qnrA5′-RACEATGAAACTGCAATCCTCGAAACTGqnrA5
GSP3-qnrA5′-RACETGGCTGAAGTCACACTGATAAAAGqnrA5
GSP1-blaCTX-M-95′-RACECCAGCGCATGACCCAGCGTAACblaCTX-M-9This study
GSP2-blaCTX-M-95′-RACEGCGTCATTGTGCCGTTGACGTGTblaCTX-M-9This study
GSP3-blaCTX-M-95′-RACEGCACCGCACTCGTCTGCGCATAblaCTX-M-9This study
GSP1-blaCTX-M-25′-RACECGCGAGCGGCGTGGTGGTATblaCTX-M-2This study
GSP2-blaCTX-M-25′-RACECGTTCATCGGCACGGTAGAGAAblaCTX-M-2This study
GSP3-blaCTX-M-25′-RACECCAAGCCGACCTCCCGAACTTblaCTX-M-2This study
GSP1-dfrA105′-RACEGCACCCCAACCAGCGAAGCTdfrA10This study
GSP2-dfrA105′-RACEGCACTTCGTGCTCTGTGATAGTTdfrA10This study
GSP3-dfrA105′-RACEGCCTTGATTACCGAATGCTCTdfrA10This study