TABLE 1.

Sequence of primers for detection of bla genes or genotyping of strains

TargetPrimer namePrimer sequence (5′-3′)PositionReference or accession no.
Detection primers
    blaSHVOS-5TTA TCT CCC TGT TAG CCA CC23-42Y11069
    OS-6GAT TTG CTG ATT TCG CTC GG799-818
    blaTEMCTCGGGGAAATGTGCGCG90-10532
    DTGCTTAATCAGTGAGGCACC1042-1062
    blaCTX-MMA-1SCS ATG TGC AGY ACC AGT AA270-289X92506
    MA-2CCG CRA TAT GRT TGG TGG TG794-813
    blaCTX-M-14, 17 Toho-2M9UATG GTG ACA AAG AGA GTG CA112-131D89862
    M9LCCC TTC GGC GAT GAT TCT C957-975
    blaVEB-1VEBcas-FCGA CTT CCA TTT CCC GAT GC128-151AF010416
    VEBcas-BGGA CTC TGC AAC AAA TAC GC1198-1180
    blaOXA-10OXA-10scaFTTA GGC CTC GCC GAA GCG7331-7348AF205943
    OXA-10casBCTTTGTTT TAG CCA CCA ATG ATG8297-8319
    blaPER-1PER-AATG AAT GTC ATT ATA AAA GC309-32822
    PER-BAAT TTG GGC TTA GGG CAG AA1233-1214
    blaGES-1GES-1AATG CGC TTC ATT CAC GCA C1322-134028
    GES-1BCTA TTT GTC CGT GCT CAG G2095-2077
    blaCTX-M upstreamISEcpl-LCCT AGA TTC TAC GTC A1138-11595
    CTX-2STTG CTG CAC CGC ACT CGT3211-3194
Genotyping primer (rep-PCR)
BOX-A1CTACGGCAAGGCGACGCTGACG11
ER1C2AAGTAAGTGACTGGGGTGAGCG35