TABLE 3.

Primers used for PCR and RT-PCR

PrimerSequence (5′ to 3′)Positionsa
PAFCTTGCAAGACGTTGACTTCA2120-2139
PARGGTAGCCAAACCTAGAGCAT2960-2979
PBFGACTCCTCTATGGCGATGATGAT4346-4368
PBRGCCCTAAAGTTATCAACGC4945-4963
PCFGGTTGAAGATGATACAACC4876-4895
PCRCAAGATCACTTGGTGCAG5763-5780
P5FAGGCATACGCCGTGATACTA7570-7589
P5RCAATGACTGATGCTTGATC6970-6988
RT1GTAACATAAACCTGTGTTCCTTG6437-6459
RT2ACCAGTCACCAGACTTGTTGGTTCCTC6876-6892
  • a The numbers give the positions on a 7.7-kb HindIII fragment sequenced in this study (EMBL/GenBank/DDBJ data bank accession no. AB078507).