TABLE 1.

Primers used for PCR amplification of β-lactamase genes

GenePrimerSequence (5′→3′)PCR product size (pb)
E. coli ampC promoterAB1GATCGTTCTGCCGCTGTG271
AmpC2GGGCAGCAAATGTGGAGCAA
TEMForwardATGAGTATTCAACATTTCCG867
ReverseCTGACAGTTACCAATGCTCTC
SHVForwardGGTTATGCGTTATATTCGCC867
ReverseTTAGCGTTGCCAGTGCTC
OXA-1OXA-1FACACAATACATATCAACTTCGC814
OXA-1RAGTGTGTGTTTAGAATGGTGATC
OXA-2OXA-2FTTCAAGCCAAAGGCACGATAG704
OXA-2RTCCGAGTTGACTGCCGGGTTG
OXA-10OXA-10FCGTGCTTTGTAAAAGTAGCAG651
OXA-10RCATGATTTTGGT GGGAATGG