TABLE 3.

Drug binding to 6-mer single-stranded DNA oligonucleotides

DrugApparent Kd (μM)aCalculated stoichiometry
TGGCCTTAACCTTGGCCTTAACCT
PD0117962163.7 ± 21.3789.5 ± 102.71.8 ± 0.101.8 ± 0.16
PD012960387.6 ± 18.6684.9 ± 92.01.8 ± 0.142.2 ± 0.19
PD016344988.6 ± 22.6837.5 ± 125.31.8 ± 0.162.4 ± 0.25
Ciprofloxacin115.4 ± 24.0480.1 ± 23.02.4 ± 0.192.3 ± 0.07
PD011448848.4 ± 15.3750.4 ± 116.61.6 ± 0.152.0 ± 0.21
Difloxacin164.7 ± 12.5693.0 ± 98.91.5 ± 0.051.0 ± 0.10
Ofloxacin234.2 ± 55.9550.2 ± 51.41.6 ± 0.191.0 ± 0.06
Enoxacin240.4 ± 36.91180.1 ± 203.22.2 ± 0.162.9 ± 0.38
Norfloxacin336.4 ± 87.11599.0 ± 352.13.5 ± 0.485.9 ± 1.04
Pefloxacin196.0 ± 15.4752.3 ± 136.01.3 ± 0.041.1 ± 0.14
Oxolinic acid164.4 ± 21.21057.0 ± 256.50.6 ± 0.031.0 ± 0.18
Piromidic acid604.3 ± 112.3778.2 ± 242.61.0 ± 0.120.6 ± 0.12
  • a Kdapp were determined from quinolone-binding titrations by SPR (Fig. 3).