TABLE 1.

Nucleotide and amino acid substitutions in the cyp51A and cyp51B genes from A. fumigatus clinical isolates

IsolateBase changeMIC (μg/ml)b
cyp51Acyp51B
Codon 54Codon 236Codon 35Codon 42Codon 187Codon 387Codon 394ITCVRZFCZKTZ
CM-237GGGATGTCTCAGTTCGATCCT0.250.56408.0
AF-1119GGGATGTCTCAGTTCGATCCT0.50.56408.0
CM-1369GGGATGTCTCAGTTCGATCCT0.250.56408.0
AF-72 161GAGbATGTCT 125CTGi 664TTTjGATCCT>8.00.251601.0
AF-1237 160 AGGfATGTCTCAGTTCGATCCT>8.00.51602.0
CM-796 161GTGdATG 105TCChCAGTTCGATCCT>8.01.06408.0
CM-1910GGGATG 105TCChCAGTTCGATCCT>8.04.03,200>8.0
AF-91GGG 729 GTGc 105TCChCAGTTCGATCCT>8.01.03,200>8.0
AF-90GGG 729 GTCa 105TCChCAGTTCGATCCT>8.01.03,200>8.0
AF1422GGG 729 GTGc 105TCChCAGTTCGAT 1285CCGl>8.01.03,200>8.0
F/6919GGG 730AAGeTCTCAGTTCGATCCT>8.02.03,2008.0
F/7075 161GAGbATGTCTCAGTTCGAT 1285CCGl>8.00.53202.0
Br130 161GAGbATGTCT 125CTGi 664TTTjGAT 1285CCGl>8.00.51601.0
Br181 161GTGdATGTCTCAGTTCGATCCT>8.00.251602.0
SO/3829GGG 730ACGgTCTCAGTTC 1284GAAk 1285CCAl>8.01.01,6008.0
T-21 161GAGbATGTCTCAGTTCGATCCT>8.00.51601.0
T-23 161GAGbATGTCTCAGTTCGATCCT>8.00.25801.0
  • a Nucleotides are numbered from the translation start codon ATG of cyp51A and cyp51B. The numbers indicate the position at which a base change occurs (in bold).

  • b Amino acid substitution, G54E.

  • c Amino acid substitution, M236V.

  • d Amino acid substitution, G54V.

  • e Amino acid substitution, M236K.

  • f Amino acid substitution, G54R.

  • g Amino acid substitution, M236T.

  • h Amino acid substitution, S35S.

  • i Amino acid substitution, Q42L.

  • j Amino acid substitution, F187F.

  • k Amino acid substitution,D387E.

  • l Amino acid substitution, P394P.