TABLE 1.

Primers used for amplification and sequencing of rpoB

PrimerSequenceaUseReference or source
31fTTTACAACCATATGACGATTAGAAPCR and sequencingThis study
372fGGGACGTTCGTNATHAAYGGPCR and sequencing16
642rTGAGAAACCAAGAGCACGAACCPCR and sequencingThis study
2380rTCGCGAGTGATYTCYTCMGGPCR and sequencing16
3733rCAACCACTATTTCTTCCCTTTCTAPCRThis study
399fGATGAYATCGAYCACCTCGGAAASequencing8
525r GATGTTAGGTCCTTCAGGTGTCTCSequencing8
1440fTTGTCACARTTYATGGAYCASequencing16
1570rATACATGCTGTCGCAACGGCSequencingThis study
  • a The nucleotides modified for this study are highlighted in boldface.