TABLE 1.

Primers used to amplify regions of pneumococcal genomic DNA contaning type II topoisomerase genes

DescriptionDesignationSequence (5′ to 3′)
gyrA forward primerSPGYRAFGAGGCTGAAATAGATGGGAATT
gyrA reverse primerSPGYRARCTGCTAGGATATTTGTCAGC
gyrB forward primerSPGYRBFCCAGTATCGTGAATTTAAGACA
gyrB reverse primerSPGYRBRTCCATTAGACATATCAAACTCC
parC forward primerSPPARCFTTGTGAGTTTGCTTACTTCAAG
parC reverse primerSPPARCRGTCATATTCCACTCCTTATTC
parE forward primerSPPAREFAGAGAATCTCTGCTGAAATTGT
parE reverse primerSPPARERCACATAGTCATTCACATCCGA