TABLE 1.

PCR primers used in this study

Primer nameSequence
Y572-015′ ATGCCGTGGGTCGGCTCCGCCG 3′
Y572-025′ CACCACCAAAAGGTAAGTAAGGGG 3′
IPCR-15′ GAGTGGTGAGATGGGTGTAAGCAT 3′
IPCR-25′ GGTGTTGCATCCCCTTACTTACCT 3′
CK14DM15′ CGGGATCCTCTCTAGCAACAACAATGTCCG 3′
CK14DM25′ CGGGATCCTTGATTGTCGATTTTGGTTT 3′
CA14DM15′ CGGGATCCAATATGGCTATTGTTGAAACT 3′
CA14DM25′ CGGGATCCAAACATACAAGTTTCTCTTTTTTC 3′