TABLE 1.

Primers used for 23S and riboprotein amplification and sequencing

PCR and primer designationSequence 5′ to 3′Amplicon size
Primary allele PCR
    DF23FGTTAATAAGGGCGCACGGTG
    4DS18RGCCAGCTGAGCTACACCGCC4 kb
    4DS23RTACACACTCACATATCTCTG4 kb
    4DS30RTTTTACCACTAAACTACACC4 kb
    4DS91RTACCAACTGAGCTATGGCCGG4 kb
Nested PCR
    23S 2058 region
        DF-SPN-23S-F1AGCGAAGGTATGAATTGAAGC279 bp
        DF-SPN-23S-R1AACTGGCGTCCCGATCTC
    23S 2611 region
        DF-SPN-23S-F2GGTTTGGCACCTCGATGTCG276 bp
        DF-SPN-23S-R2TCACACTTAGATGCTTTCAGC
    23S 2505 region
        DF-SPN-23S-F1AGCGAAGGTATGAATTGAAGC892 bp
        DF-SPN-23S-R2TCACACTTAGATGCTTTCAGC
    23S 752 region
        DFDOM2FGGCGAGTTACGTTATGATGC289 bp
        DFDOM2RGCTCTACCTCCAAGAATCTC
L4 and L22 hotspots
    DF-L22-FGAACTCAGCTGTAGCTAACGC176 bp
    DF-L22-RTTCTGCAACAGCTACAGTGATG
    DF-L4-FAGCGATGCAGTATTTGGTATCG238 bp
    DF-L4-RGCCGTATGAACGTGGAGTTG