TABLE 1.

Primers used for DNA amplification

PrimerNucleotide sequence (5′ → 3′)Position (nt)aReference
GyrA1TTATGCCATGAGCGAGCTGGGCAACGACT147-176 in gyrA20
GyrA2AACCGTTGACCAGCAGGTTGGGAATCTT484-512 in gyrA20
GyrB1GCGCGTGAGATGACCCGCCGT1162-1182 in gyrB28
GyrB2CTGGCGGTAGAAGAAGGTCAG1531-1551 in gyrB28
PARC1ATGAGCGAACTGGGGCTGGAT166-187 in parCThis study
PARC2ATGGCGGCGAAGGACTTGGGA354-375 in parCThis study
ParE1CGGCGTTCGTCTCGGGCGTGGTGAAGGA1223-1250 in parE2
ParE2TCGAGGGCGTAGTAGATGTCCTTGCCGA1787-1814 in parE2
MexR20CCAGTAAGCGGATACDownstream of mexRThis study
MexRINTGGATGATGCCGTTCACCTG205-223 in mexAThis study
P860bCACATGCTGGAAGACCG320-336 in mexRThis study
P793bCATTAGGTTTACTCGGC253-269 in mexRThis study
MexZ2060CCAGCAGGAATAGGCCGACCAGGGC43-47 in mexXThis study
MexZ1026CAGCGTGGAGATCGAAGGCAGCCGGUpstream of mexZThis study
MexZ2cGGCTCGTTCTCGTCGCTG345-362 in mexZThis study
MexZ2PcCAGCGACGAGAACGAGCC345-362 in mexZThis study
  • a Numbering of nucleotides (nt) is according to deposited sequences of gyrA (L29417 [20]), gyrB (Y16286 [28]), parC (AB003428 [1]), parE (AB003429 [1]), mexA (L11616 [37]), mexR (U23763 [38]), and mexZ and mexX (AF073776 [39]).

  • b Primers used to facilitate mexR and mexR-mexA intergenic region sequencing.

  • c Primers used to facilitate mexZ and mexZ-mexX intergenic region sequencing.