TABLE 2.

Primers used in this studya

PrimerGeneSequence (5′ to 3′)TannealingAmplicon size (bp)
PCOE FpcoEGTGGGGCAGCTTTTGCTCAGTCCAGTGA63385
PCOE RCGAAGCTTTCTTGCCTGCGTCTGATGTG
PCOA FpcoAATCCGGAAGGTCAGCACCGTCCATAGAC63507
PCOA RGACCTCGCGGATGTCAGTGGCTACACCT
PCOD FpcoDGGCGCCCAGAATGATAATCGCAACA63502
PCOD RGGGCGTGGCGCTGGCTACACTT
TERX FterXATGCGCCGCCTGCCTGTTTACCTTGTTA63576
TERX RCGCGCTTGTGCTGCCGGAAGACA
TERF FterFCCGACAAACTTCCAGAAGATGGGGTAGT63428
TERF RGAGGCAGCGGTTGCATTTGTACTTGACG
TERY3 FterY3CCTGGGGCCGTCAGCGGACCTG63302
TERY3 RTCCTTGCTGGTGGCCGTTCATACTTCAT
TERD FterDCCACTGCGCGGAATTTCCACTCACCAT63231
TERD RACGCCGTCCCGTCTGATGTTGACAAG
SILE FsilETCGGCCTGGGCCACTGAAACCGTGAATA63364
SILE RGGCGGTGCGCTTCGGCCATAGCCTGATG
SILP FACACCCCGGCCTGGGCTCCTT63603
SILP RsilPTGCGGGCACGGGAACAAACCTC
AAC3-VI Faac3-VIGGGCAAGCGCCGCGTCACTTATT63302
AAC3-VI RCGCGGCGTTGTTTCGGCTTCA
AADA FaadATAACGGCGCAGTGGCGGTTTTCA63365
AADA RAAGCTCGCCGCGTTGTTTCATCAAG
GROEL FgroELCGCCGGCATGAACCCGATGGACCTCA63318
GROEL RTCGGCCTGCATCGACTGCGGGTTGTTG
HI2 FrepATTTCTCCTGAGTCACCTGTTAACAC63644
HI2 RGGCTCACTACCGTTGTCATCCT
  • a The source of all primers is this study.