TABLE 1.

Primers for amplification of genes from Acinetobacter sp. isolates

Primer namePrimer sequence (5′ to 3′)aAnnealing temp (°C)Target gene(s)Source or reference
SHV PROXATGCGTTATATTCGCCTGTG60All blaSHV genes33
SHV DISTGCTTTGTTATTCGGGCCAA
TEM 285AAACGCTGGTGAAAGTA45All blaTEM genes33
TEM 2023AGCGATCTGTCTAT
CTX-M2-1ATGATGACTCAGAGCATTCGCCGCT70blaCTX-M-2, blaCTX-M-4, blaCTX-M-5,33
CTX-M2-2TCAGAAACCGTGGGTTACGATTTTCG    blaCTX-M-20, blaCTX-M-31, blaCTX-M-35, blaTOHO-1
VEB-1 FORATGAAAATCGTAAAAAGGATATT47blaVEB-1, blaVEB-1A, blaVEB-1B, blaVEB-2,This study
VEB-1 REVTTATTTATTCAAATAGTAATTCC    blaVEB-3
PER F-1ATGAATGTCATTATAAAAG44blaPER-1This study
PER R-2TTGGGCTTAGGGCAG
IMP FORGTTTATGTTCATACWTCG45blaIMP-1, blaIMP-2, blaIMP-4, blaIMP-5,This study
IMP REVGGTTTAAYAAAACAACCAC    blaIMP-6, blaIMP-7, blaIMP-8, blaIMP-9, blaIMP-10, blaIMP-11, blaIMP-15, blaIMP-19, blaIMP-20, blaIMP-21
VIM FORTTTGGTCGCATATCGCAACG66blaVIM-1, blaVIM-2, blaVIM-4, blaVIM-5,This study
VIM REVCCATTCAGCCAGATCGGCAT    blaVIM-6, blaVIM-8, blaVIM-9, blaVIM-10, blaVIM-11, blaVIM-12
GIM FORATATTACTTGTAGCGTTGCCAGC61blaGIMThis study
GIM REVTTAATCAGCCGACGCTTCAG
ADC-7 FORATGCGATTTAAAAAAATTTCTTGT50blaADC-1, blaADC-2, blaADC-3, blaADC-4,21
ADC-7 REVTTATTTCTTTATTGCATTCAG    blaADC-5, blaADC-6, blaADC-7
OXA SET A FORATGAAAAAATTTATACTTCC47blaOXA-24, blaOXA-25, blaOXA-26, blaOXA-33,This study
OXA SET A REVTTAAATGATTCCAAGATTTTC    blaOXA-40, blaOXA-72
OXA SET B FORTCTGGTTGTACGGTTCAGC51blaOXA-23, blaOXA-27, blaOXA-49This study
OXA SET B REVAGTCTTTCCAAAAATTTTG
OXA SET C FORACAGAARTATTTAAGTGGG47blaOXA-51, blaOXA-58, blaOXA-64, blaOXA-69,This study
OXA SET C REVGGTCTACAKCCMWTCCCCA    blaOXA-70, blaOXA-71, blaOXA-75, blaOXA-78
OXA SET D FORTAGCACTGCTTTTCTCAGCTG51blaOXA-20, blaOXA-37This study
OXA SET D REVTTGACGGATTGAAGAATAGCACG
OXA1FACACAATACATATCAACTTCGC50blaOXA-1, blaOXA-4, blaOXA-30, blaOXA-31,This study
OXA1RGTGTGTTTAGAATGGTGATC    blaOXA-47
OXA58-5′ATGAAATTATTAAAAATATTGAGTTTAG53blaOXA-58, blaOXA-96This study
OXA58-3′TTATAAATAATGAAAAACACCCAAC
Hep35TGCGGGTYAARGATBTKGATTT49Conserved region intI1, intI2, intI353
Hep36CARCACATGCGTRTARAT
Hep58TCATGGCTTGTTATGACTGT55Class 1 integron cassette array53
Hep59GTAGGGCTTATTATGCACGC
ISABA1aATGCAGCGCTTCTTTGCAGG55ISABA119
ISABA1bAATGATTGGTGACAATGAAG
IS1133 forAGTACAAAAGCTGTGAGATTTCAG58IS1133This study
IS1133 revGATATTCATGAGCGCAATATTGGCT
adeR-5′ATGTTTGATCATTCTTTTTCTTTTG46adeR (regulatory gene of AdeABCThis study
adeR-3′TTAATTAACATTTGAAATATG    efflux gene cluster)
adeE-5′ATGTTGTCGAGTTTTTTTATTGCACG60adeE (efflux gene of AdeDE)This study
adeE-3′TCATTTTGCCTTTTTGGTATTTAAC
aacA4 FORATGACTGAGCATGACCTTGCG65aacA4This study
aacA4 REVTTAGGCATCACTGCGTGTTCG
aacC1-5′ATGGGCATCATTCGCACATGTAGG64aacC1This study
aacC1-3′TTAGGTGGCGGTACTTGGGTC
aadA1-5′ATGAGGGAAGCGGTGATCG62aadA1This study
aadA1-3′TTATTTGCCGACTACCTTGGTG
aadB-5′ATGGACACAACGCAGGTCGC68aadBThis study
aadB-3′TTAGGCCGCATATCGCGACC
aphA6 FORATGGAATTGCCCAATATTATTC55aphA6This study
aphA6 REVTCAATTCAATTCATCAAGTTTTA
aacC2 FORATGCATACGCGGAAGGCAATAAC65aacC2This study
aacC2 REVCTAACCGGAAGGCTCGCAAG
gyrA-1AAATCTGCCCGTGTCGTTGGT63gyrA (QRDRb)52
gyrA-2GCCATACCTACGGCGATACC
parC-1AAACCTGTTCAGCGCCGCATT58parC (QRDR)51
parC-2AAAGTTGTCTTGCCATTCACT
QnrAGGGTATGGATATTATTGATAAAG52qnrA27
QnrBCTAATCCGGCAGCACTATTA
CarO 5′ATGAAAGTATTACGTGTTTTAGTG50carOThis study
CarO 3′TTACCAGTAGAAGTTTACACC
  • a Y = C or T; M = A or T; R = A or G; B = C, G, or T; W = A or T; K = G or T.

  • b QRDR, quinolone resistance-determining region.