TABLE 5.

Primers used for detection of genes encoding class A ESBLs in P. aeruginosa

Primer nameSequence (5′ to 3′)Gene detectedReference(s)
VEB-1ACGACTTCCATTTCCCGATGC bla VEB 43
VEB-1BGGACTCTGCAACAAATACGC
PER-AATGAATGTCATTATAAAAGC bla PER 10, 45
PER-BAATTTGGGCTTAGGGCAGAA
GES-1AATGCGCTTCATTCACGCAC bla GES 45
GES-1BCTATTTGTCCGTGCTCAGG
TEM-AGAGTATTCAACATTTCCGTGTC bla TEM 45
TEM-BTAATCAGTGAGGCACCTATCTC
SWSHV-AAAGATCCACTATCGCCAGCAG bla SHV 31
SWSHV-BATTCAGTTCCGTTTCCCAGCGG