TABLE 2.

Oligonucleotides used in this study

PrimerSequence (5′ to 3′)a
S83W-TGCTGCGCCATGCGGACGATCGTGTCA TAGACCGCCCAGTCACCATGGGGAT GGTATTTACCGATTACGTCA
gyrA-QFGACCTTGCGAGAGAAATTACAC
gyrA-QRGATGTTGGTTGCCATACCTACG
gyrA-IF1TGCTGGTGAACGGTTCTTCC
gyrA-IR1GTACGACGGGTCACCACTTC
gyrA-IF2CATCGCGGCGTTTGTTCGTC
gyrA-IR2CTTAACGTAGCCCTGGTGAG
gyrA-IF3TCACCCAGGAAGATGTGGTC
gyrA-IR3GCCACGAGGCACGATCAGAG
gyrA-IF4GTATTCGCTTAGGTGAAGGC
gyrA-IR4CCAGACTTTGCAGCCTGGAC
  • a A point mutation is boldfaced.