TABLE 2.

Sequences of primers used in this study

PrimerSequence (5′→3′)LocationNo. as shown in Fig. 1
ISEcp1AGCAGGTCTTTTTCTGCTCCISEcp1B transposase1
ISEcp1BTTTCCGCAGCACCGTTTGCISEcp1B transposase, reverse primer2
PRECTX-M-3BCCGTTTCCGCTATTACAAAC3′ end of blaCTX-M, reverse primer3
PROM+TGCTCTGTGGATAACTTGCRight part of ISEcp1B including −35 and −10 promoter sequences4
PROM−GCAGTCTAAATTCTTCGTGRight part of ISEcp1B lacking −35 and −10 promoter sequences5
CTX-M-REVCCGCGAACATCATCCGTTGC5′ end of blaCTX-M-19, reverse primer for primer extension experiments6
IS903-ACATATGAAATCATCTGCGCIS903D transposase7
IS903-BCCGTAGCGGGTTGTGTTTTCIS903D transposase, reverse primer8
INT2FTCTCGGGTAACATCAAGGCCC3′ end of the int11 integrase gene9
3′-CSAAGCAGACTTGACCTGA5′ end of the qacEΔ1 gene, reverse primer10
CTX-MAACCGCGATATCGTTGGT bla CTX-M-19 gene11
CTX-MBCGCTTTGCGATGTGCAG bla CTX-M-19 gene, reverse primer12
ORF1BATACTCTTGCTCATATGGGG5′ end of ORF1 of Tn1721, reverse primer13