TABLE 1.

Primers used for the QRT-PCR

GeneForward primerReverse primer
sigA TTCGCGCCTACCTCAAACAGGCTAGCTCGACCTCTTCCTCG
fabD ACCCTGGTCTCCCAGCTCACAGTTCGCGTTTGGCGATACC
acpM CAAGTACGGCGTCAAGATCCCACTTGGACTCGGCCTCAAGC
kasA TGCTCATCGAGACGGAGGAGCTACCGGCACGAACACCATC
kasB CCGTGCAGAAGTACATGCCCACCGCTTCGATCCTGGTCTC
accD6 CACACCGTTCGACGAGTTCCTCTGCGCTTTCGGAGTTCAG
Rv1685cACTTCGGCACCAAACAGCAGAACCGAGTTCCTCGACAGGC
Rv1686cTGATGTTTGTGATCACGGCGGAACCAGAACGCCACAATGC
Rv1687cGGTCGGGCAAGACAACACTGAGAGTTCGGCGAAGTAGCGG
Rv3160cCTGGACCACCTGCATGCTTCCCATCTCCGCGACTAGCTCC
Rv3161cCAGGGTTCCCTTCACCGTTCGCGGAATAAAGCCGAACCAC