TABLE 2.

Sequences of oligonucleotide primers used in this study

PrimerSequence (5′-3′)GenePosition (bp)Size (bp)
ermA5CACCCGCCTCTAGAAATAATAG erm(X)−243-7881,031
ermA3CGATGGTGATCTAGAGAGGAAC erm(X)
ermX28GGCTCTGTAACGTCTGCCGCGC repA 68-291224
ermX29TGTCCCGGCCCAAGTCCTCACC repA
ermX12GATGCCGATTCTTCCGCACTGC tetA(33)84-12241,089
ermX19CCACGCATGATGAGAATCACGC tetA(33)
ermX8TTGGACGGACGGAACGATGACG tnpA 15-736722
ermX2AGCCCAATGCCAAAAGCTCTCTC tnpA
ermX1GTTGCGCTCTAACCGCTAAGGC erm(X)−205-453657
ermX5CCATGGGGACCACTGAGCCGTC erm(X)