TABLE 1.

PCR primers

Primer pairSequence (5′-3′)
Primary sas-specific primers
    sasAFTCAACATCCTCAAAGAATACTACA
    sasARATGCGTTACTTAAGCCACCAATAC
    sasBFGTTGCAGCGCTTGTGACT
    sasBRATTTTTGAGATTTCTTCGTTTTTA
    sasDFGGCGGAGTAGTACCACAAGGAA
    sasDRAATGCTAAGAATAACCCAGATACT
    sasEFTTACAATGCAAACAATCAAGA
    sasERGTTTAGGCGTTTCGTTATGTTTT
    sasFFGGATAGCAAAGACAATAAAAGTTC
    sasFRTGATATGTGTAATGTTGCGTTGAG
    sasHFCGCACCAACTAACAAACCAACTAC
    sasHRTACGCCAATAATTCCATAACGA
    sasIFATACTATCACTTTTTCAGCATCAA
    sasIRTCATTCGTTTTATCGTTAGTATTA
Alternative sas-specific primers
    sasDF4ATTTTGTTGCATTTCTTT
    sasDR4TCACACGATTTTTCTATTAT
    sasEF2ACCCTGGTAAAGTGATT
    sasER2CTAAAAGGGCAAGTGTT
    sasIF3CAAACACTGCGAAAAACTATCCT
    sasIR3TTTCACCTTTATCATTTTTCATTT
spa-specific primersspa1095uAGACGATCCTTCGGTGA
    spa1517dCAGCAGTAGTGCCGTTTG
mec-specific primersmec
    3490uATGATTCAATGCCTAAACCTAATCG (common)
    4110AdGAATTATAACTGGGAATATTTTAAATCCCA (class B mec)
    4110BdCTTTTTGTTTCAAAGTCATACTATTTTCAAC (class A mec)