TABLE 1.

Primers used in this studya

Primer nameNo. in Fig. 3Sequence (5′-3′)
KpcA1CTGTCTTGTCTCTCATGGCC
KpcB2CCTCGCTGTGCTTGTCATCC
42813GGCACGGCAAATGACTA
47144GAAGATGCCAAGGTCAATGC
SeqRIout5ACGACCACGCACGCACAAAC
3′EndYC6GCATCAAACGGAAGCAAAAG
3781L7GCTTTCTTGCTGCCGCTGTG
3098U8TGACCCTGAGCGGCGAAAGC
905L9GCGACCGGTCAGTTCCTTCT
816U10CACCTACACCACGACGAACC
141R-611TCACCGGCCCTCACCTTTGG
5′endYC12CTTAGCAAATGTGGTGAACG
  • a All primers were developed in the present study.