TABLE 1.

Additional primers used for PCR and sequencing

PrimereSequence (5′→3′)Reference
Tn1546RGGAAAATGCGGATTTACAACGCTAAG14
VanR4 (+)(3907)a ATGCTTATAAATTCGGCCCTAThis study
VanS3 (+)(4771)a CCGAGGGAAACTTGGGGATTGThis study
VanA3 (−)(7002)a TATTGCAACTTTTATTCTATTCATGThis study
VanA4 (+)(7984)a TTGATCGTATTAGCGTTAAAGGGGThis study
IS1251-1 (+)(106)b AACCCAAAAGGAGGAATCAAGThis study
IS1251-2 (−)(1057)b CTTTGAAGCCAGGTCGCThis study
IS1251-4 (+)(1041)b GCGACCTGGCTTCAAAGThis study
6113R (−)(6113)a TATCGTTGCCATAACGC13
7875F (+)(7875)a CCGCATTGTACTGAACG13
8544F (+)(8544)a GCATATAGCCTCGAATGG13
9519F (+)(9519)a ACCAGCAGGTTATAGTGAGC13
10687F (+)(10687)a CTCGCCCGTAGGTGTGAAGTGThis study
10778F (+)(10778)a TTTAGTGCTGAGGAATTGG13
IS1216V.A (+)(90)c GGAAAGCAATTTCAGCAG13
IS1216V.C (−)(495)c CACTTGTAATAGAGGGGGC13
IS1216V.E (+)(749)c AGCTTAAATCATAGATACCGTAAGG13
UP211 (+)(211)d CCATCGATTATGAGGCTAGACAThis study
DN645 (−)(663)d ATTCTTGCACCCAACGATAThis study
  • a The primer positions correspond to the sequence of Tn1546 (GenBank accession no. M97297).

  • b The primer positions correspond to the sequence of IS1251 (GenBank accession no. AF148130).

  • c The primer positions correspond to the sequence of IS1216V (GenBank accession no. AF093508).

  • d The primer positions correspond to the sequence of the Tn1546-like element reported in this study.

  • e +, forward primer; −, reverse primer (relative to the respective sequence).