TABLE 1.

Primers for kinetic and relative quantitation PCR.

Primer nameGeneAnnealing regionPrimer sequence (5′→3′)a
16sAllBactF16s rRNA(+) 1297/1318TCCATGAAGTCGGAATCGCTAG
16sAllBactR16s rRNA(−) 1374/1392CACTCCCATGGTGTGACGG
SHV-F bla SHV (+) 310/327TCAGCGAAAAACACCTTG
Pr-FpNSF-1b(+) −107/−82GATGAAGGAAAAAAGAGGAATTGTGA
SHVquantF bla SHV (+) 730/748TGCTTGGCCCGAATAACAA
SHVquantR bla SHV (−) 766/786GCGTATCCCGCAGATAAATCA
Pr::IS26-FpMPA2ac(+) −158/−141CCGGCCTTTGAATGGGTT
Prquant-R bla SHV (−) −3/24TAATACACAGGCGAATATAACGCATAAC
Shv238mt bla SHV (+) 680/699CGCCGATAAGACCGGAGCTA
Shv238wt bla SHV (+) 680/699CGCCGATAAGACCGGAGCTG
Shv238reverse bla SHV (−) 770/781CGGCGTATCCCGCAGATAA
Shv240mt bla SHV (−) 702/716GCGCGCACCCCGCTT
Shv240wt bla SHV (−) 702/716GCGCGCACCCCGCTC
Shv240reverse bla SHV (+) 663/679CCGGCGGGCTGGTTTAT
Shv35mt bla SHV (+) 70/91AGCCGCTTGAGCAAATTAAACA
Shv35wt bla SHV (+) 70/91AGCCGCTTGAGCAAATTAAACT
Shv35reverse bla SHV (−) 174/194CATCATGGGAAAGCGTTCATC
  • a 3′ terminal bases for allele-specific oligonucleotides are underlined.

  • b GenBank accession no. AF282921 , as reported by Fortineau et al. (4).

  • c GenBank accession no. X84314 , as reported by Nuesch-Inderbinen et al. (10).