TABLE 1.

Primers for kinetic and relative quantitation PCR.

Primer nameGeneAnnealing regionPrimer sequence (5′→3′)a
16sAllBactF16s rRNA(+) 1297/1318TCCATGAAGTCGGAATCGCTAG
16sAllBactR16s rRNA(−) 1374/1392CACTCCCATGGTGTGACGG
SHV-FblaSHV(+) 310/327TCAGCGAAAAACACCTTG
Pr-FpNSF-1b(+) −107/−82GATGAAGGAAAAAAGAGGAATTGTGA
SHVquantFblaSHV(+) 730/748TGCTTGGCCCGAATAACAA
SHVquantRblaSHV(−) 766/786GCGTATCCCGCAGATAAATCA
Pr::IS26-FpMPA2ac(+) −158/−141CCGGCCTTTGAATGGGTT
Prquant-RblaSHV(−) −3/24TAATACACAGGCGAATATAACGCATAAC
Shv238mtblaSHV(+) 680/699CGCCGATAAGACCGGAGCTA
Shv238wtblaSHV(+) 680/699CGCCGATAAGACCGGAGCTG
Shv238reverseblaSHV(−) 770/781CGGCGTATCCCGCAGATAA
Shv240mtblaSHV(−) 702/716GCGCGCACCCCGCTT
Shv240wtblaSHV(−) 702/716GCGCGCACCCCGCTC
Shv240reverseblaSHV(+) 663/679CCGGCGGGCTGGTTTAT
Shv35mtblaSHV(+) 70/91AGCCGCTTGAGCAAATTAAACA
Shv35wtblaSHV(+) 70/91AGCCGCTTGAGCAAATTAAACT
Shv35reverseblaSHV(−) 174/194CATCATGGGAAAGCGTTCATC
  • a 3′ terminal bases for allele-specific oligonucleotides are underlined.

  • b GenBank accession no. AF282921, as reported by Fortineau et al. (4).

  • c GenBank accession no. X84314, as reported by Nuesch-Inderbinen et al. (10).