TABLE 1.

Primers used for PCR amplification and sequencing of the penA gene of N. gonorrhoeae

PrimerNucleotide sequence (5′ to 3′)Nucleotide positionsa
PenA-A1CGGGCAATACCTTTATGGTGGAAC8-31
PenA-B1AACCTTCCTGACCTTTGCCGTC655-676
PenA-A2AAAACGCCATTACCCGATGGG597-617
PenA-B2TAATGCCGCGCACATCCAAAG1157-1177
PenA-A3GCCGTAACCGATATGATCGA1003-1022
PenA-B3CGTTGATACTCGGATTAAGACG1844-1865
PenA-A4AATTGAGCCTGCTGCAATTGGC1376-1397
  • a The nucleotide numbering is derived from the penA gene of a penicillin-susceptible strain of N. gonorrhoeae (GenBank accession no. M32091).