TABLE 2.

Oligonucleotide primers used in PCR or Southern blot analysis

PrimerSequence (5′-3′)Description
PMAC-ori-XbaI-FTCTAGAGCTCAGTTGGTTTTATCCAAAG ori and repM of pMAC
PMAC-ori-SphI-RGCATGCCTATGCAGCTTTGAAGCCTAC
XbaIIS1008TCTAGATCGGCACTTTCAAGGTGAAATIS1008
XbaIΔISAba3TCTAGAGCTAGAGTTATTTGCATTTCTCΔISAba3
NcoIOXA58CCATGGTTATAAATAATGAAAAACACCCAEnd of blaOXA-58
OXA58-FaAAGTATTGGGGCTTGTGCTGInternal fragment of blaOXA-58; used for Southern blot analysis and PCR
OXA58-BaCCCCTCTGCGCTCTACATAC
OXA51-BaTGGATTGCACTTCATCTTGG bla OXA-51
OXA-58-ext-1GTGGCTTTCCATCCCACTTAUsed for 5′ RACE
OXA-58-ext-2GCGCTTGAACATTCTGATCGUsed for nested PCR; upstream of OXA-58-ext-1
ISAba1BbCATGTAAACCAATGCTCACC tnpA of ISAba1
ISAba2AbAATCCGAGATAGAGCGGTTC tnpA of ISAba2
ISAba3CbAGCAATATCTCGTATACCGC tnpA of ISAba3
IS18BbACCAGCCATAACTTCACTCG tnpA of IS18
Oligo(dG)AAATCTAGAGGGGGGGGGGGUsed for PCR of dC tailed cDNA
PEU-7GCAAACAGGATTAGATACCC16S rRNA; used as internal control in RT-PCR
PEU-8CGTCATCCCCACCTTCCTCC
  • a As described in reference 38.

  • b As described in reference 32.