TABLE 2.

Primers used in this study

PrimerOrientation (5′ → 3′)Sequence (5′ → 3′)Purpose
FKS1-453-URA3FaSenseAAAGAGACCCGTACTTGGTTACATTTGGTCACCAACTTCAGAGTGCACCATACCACAGCT S. cerevisiae mutant generation
FKS1-649-URA3RaAntisenseGTATTCACCTGTACACCTCATTGCAGTGGTGGACAAAATTGGTATTTCACACCGCATAGG S. cerevisiae mutant generation
FKS1-mut647RbAntisenseATTCACCTGTACACCTCATTGCAGTGGTGGACAAAATTCTAATTGNATCTCTCAAAGATA S. cerevisiae mutant generation
FKS1-375FSenseGGTCGTTTTGTCAAGCGTGA S. cerevisiae mutant generation
FKS1-707RAntisenseGATTTCCCAACAGAGAAAATGG S. cerevisiae mutant generation
URA3iR2AntisenseTGCCTTTAGCGGCTTAACTG S. cerevisiae mutant generation
1HS1FSenseAATGGGCTGGTGCTCAACAT Candida universal FKS1 primers
1HS1RAntisenseCCTTCAATTTCAGATGGAACTTGATG Candida universal FKS1 primers
1HS2FSenseAAGATTGGTGCTGGTATGGG Candida universal FKS1 primers
1HS2RAntisenseTAATGGTGCTTGCCAATGAG Candida universal FKS1 primers
CoinsHS1FSenseGGTATGGTGATATTGTCTG C. orthopsilosis hot spot 1 sequencing
CoinsHS2RAntisenseGGTATGGTGATATTGTCTG C. orthopsilosis hot spot 2 sequencing
CminsHS1FSenseCAGAGAACATTTGTTAGCC C. metapsilosis hot spot 1 sequencing
CminsHS2RAntisenseGTATAACGTCTGATCCAGTC C. metapsilosis hot spot 2 sequencing
CpFKS1expFSenseATCCAAGATCTTCCGGTGCCTCAAExpression profiling
CpFKS1expRAntisenseATCAGCTGACCATGCTGGATATGGExpression profiling
CpFKS2expFSenseAATGGGCAGAGGTTGAGAAGGTAGExpression profiling
CpFKS2expRAntisenseGGGTTCCAAGCAGGATATGGATCAExpression profiling
CpFKS3expFSenseTCGTAGGTTCGAATCCTGCTGAGAExpression profiling
CpFKS3expRAntisenseATGGTGAAGGCGCAACGGTGTAAAExpression profiling
CaFKS1expFSenseTGATACTGGTAATCATAGACCAAAAAExpression profiling
CaFKS1expRAntisenseAACTCTGAATGGATTTGTAGAATAAGGExpression profiling
CaFKS2expFSenseACTTGCTAGCAGTCGCCAATExpression profiling
CaFKS2expRAntisenseACCACCATGAGCGGTTAGACExpression profiling
CaFKS3expFSenseACCTCAATATTCAGCTTGGTGCCCExpression profiling
CaFKS3expRAntisenseGGACAACTCATTCGACTTGACCGTExpression profiling
CgFKS1expFSenseCAATTGGCAGAACACCGATCCCAAExpression profiling
CgFKS1expRAntisenseAGTTGGGTTGTCCGTACTCATCGTExpression profiling
CgFKS2expFSenseTACCAACCAGAAGACCAACAGAATGGExpression profiling
CgFKS2expRAntisenseTCACCACCGCTGATGTTTGGGTExpression profiling
CgFKS3expFSenseGGGAGAGCACGTAAACGTAACTCAAExpression profiling
CgFKS3expRAntisenseTTTGCTGCTGTAAGGTTAGTGGCGExpression profiling
But33SenseATGATAGAGTTGAAAGTAGTTTGGTCAATAExpression profiling (C. parapsilosis housekeeping gene)
But34AntisenseACTACTGCTGAAAGAGAAATTGTTAGAGACExpression profiling (C. parapsilosis housekeeping gene)
CaURA3FSenseCAACACTAAGACCTATAGTGAGAGAGCExpression profiling (C. albicans housekeeping gene)
CaURA3RAntisenseTGCACATAAATTGGTTTTCTTCAExpression profiling (C. albicans housekeeping gene)
CgURA3FSenseCGAGAACACTGTTAAGCCATTGExpression profiling (C. glabrata housekeeping gene)
CgURA3RAntisenseCACCATGAGCGTTGGTGATAExpression profiling (C. glabrata housekeeping gene)
  • a Sequences corresponding to URA3 flanking sequences in pRS416 are underlined.

  • b Codon 647, incorporating N into the first position, is underlined.