TABLE 3.

Primers and fluorescent probes used for PCR and RT-PCR

Gene(s)Product size (bp)PurposeSequence (5′→3′) of:
Forward primerReverse primerFluorescent probea
acrAB4,859TOPO cloningATCCACTAATGACGTCGCGCAGAGTAAATGCCTGAACGNAb
acrA72RT-PCRACCTGCGTCTGAAACAAGAAATCCCAGGCTGACAGCAACTTTACCCCAGCGGTGCCGTGGATAAAGAAC
rrsE71RT-PCRTTGACGTTACCCGCAGAAGAAGCTTGCACCCTCCGTATTACCTAACTCCGTGCCAGCAGCCG
  • a Labeled with 6-carboxyfluorescein (6′-FAM) at the 5′ end and with 6-carboxytetramethylrodamine (TAMRA) at the 3′ end.

  • b NA, not applicable.