TABLE 1.

Oligonucleotides used as primers for PCR amplification

GeneForward primer sequence (5′ to 3′)Reverse primer sequence (5′ to 3′)Expected product size (bp)Reference or Genbank accession no.
blaPSE1TTTGGTTCCGCGCTATCTGTACTCCGAGCACCAAATCCG1507
blaTEMGCACGAGTGGGTTACATCGAGGTCCTCCGATCGTTGTCAG3107
blaCMY-2ATGATGAAAAAATCGTTATGCTTGCAGCTTTTCAAGAATGCGC114337
aphA1-IabAAACGTCTTGCTCGAGGCCAAACCGTTATTCATTCGTGA50012
aadAGTGGATGGCGGCCTGAAGCCAATGCCCAGTCGGCAGCG52819
aadA2CGGTGACCATCGAAATTTCGCTATAGCGCGGAGCGTCTCGC250AF071555
strACCTGGTGATAACGGCAATTCCCAATCGCAGATAGAAGGC54819
tetA(A)GCTACATCCTGCTTGCCTTCCATAGATCGCCGTGAAGAGG210X61367
tetA(B)TTGGTTAGGGGCAAGTTTTGGTAATGGGCCAATAACACCG65918
tetA(G)GCTCGGTGGTATCTCTGCAGCAACAGAATCGGGAAC464S52437
sulICTTCGATGAGAGCCGGCGGCGCAAGGCGGAAACCCGCGCC43531
Class 1 integronGGCATCCAAGCACAAGCAAGCAGACTTGACTGATVariablea18
qacEATCGCAATAGTTGGCGAAGTCAAGCTTTTGCCCATGAAGC21031
  • a The amplicon size of class 1 integron may be variable, depending on the sizes and the numbers of the gene inserts. However, if no resistance gene cassette is inserted, the expected size is 153 bp.