TABLE 2.

Primers and fluorescent probes used for PCR

GeneProduct size (bp)PurposeForward primer (5′-3′)Reverse primer (5′-3′)Fluorescent probea (5′-3′)
NAbNAInverse PCR primer 1GTTTCCCGTTGAATATGGCTGGGNANA
NANAInverse PCR primer 2GCAGTTTCATTTGATGCTCGANANA
ramA 575TOPO cloningGGATGAACCGTATCAACGCCATTGAGTATCTGGTGCNA
ramA 335Probe for Northern analysisGCATATGACGATTTCCGCTCAGACTGTGGTTCTCTTTGCGNA
acrA 557Probe for Northern analysisTTCTGATGCTCTCAGGCTGACCATTCTGTACCAGCNA
rrsE 525Probe for Northern analysisGTAGCTAATACCGCATAACGTCGCGCTACACCTGGAATTCTACCNA
ramA 66RT-PCRGCATCAACCGCTGCGTATTCGTTGCAGATGCCATTTCGATCGCTCGCCATGCCGGGTAT
rrsE 71RT-PCRTTGACGTTACCCGCAGAAGAAGCTTGCACCCTCCGTATTACCTAACTCCGTGCCAGCAGCCG
  • a Labeled with 6′-FAM at the 5′ end and with TAMRA at the 3′ end.

  • b NA, not applicable.