TABLE 1.

Oligonucleotide sequences used to target porB1b and mtrR sequence variations in this study

Primer or probe (purpose)5′ → 3′ sequence
penB-F (forward primer)AAAGGCCAAGAAGACCTCGGC
penB-R (reverse primer)GAGAAGTCGTATTCCGCACCG
penB-P1 (anchor probe)GCAGCCTGAACAGCCCCCTGAAA-fluorescein
penB-P2 (sensor probe 1)LC Red-640-CACCGGCGCCAACGT-phosphate
penB-P3 (sensor probe 2)LC Red-705-CACCAAGGACAACGTCAATGCTTG-phosphate
mtrR-F (forward primer)GCAAAGCAGGTTATACCTGTT
mtrR-R (reverse primer)TTCAAGGCTTCGGTTTTGG
mtrR-P1 (sensor probe)ACATACACGATTGCACGGATAAAAAGTCT-fluorescein
mtrR-P2 (anchor probe)LC Red-670-TTTATAATCCGCCCTCGTCAAACCGACCC-phosphate
mtrRcod-F (forward primer)CCTCGTCAAACCGACCC
mtrRcod-R (reverse primer)CCAAGTTGTCCATCATTATCCC
mtrRcod-P1 (sensor probe)CGCTCAACGAAATCGCCCAAGCCGCCG-fluorescein
mtrRcod-P2 (anchor probe)LC Red-640-GTAACGCGCGACGCGCT-phosphate