TABLE 1.

Molecular beacon and HP assays used for the first time in this study

AssayPurposePrimer or MBaSequenceb
IniA(H481Q) (cat to caG)MB assay forward primerFiniA481ggccggatggaatcgaaa
MB assay reverse primerRiniA481cgccgccataggaaccc
MB complementary to iniA(481H)MBIniA481TFAM-TCCGCGcggggccataaaatgat CGCGGA- DABCYL
MB complementary to iniA(481Q)MBIniA481GTET-ACCGCCcggggccagaaaatgat GGCGGT- DABCYL
HP assay primer complementary to iniA(481H)FHPIniA481atggccactgccccggggccat
HP assay primer complementary to iniA(481Q)FHPIniAH481Qctggccactgccccggggccag
HP assay shared primerRIniA481cgccgccataggaaccc
GyrA(T95S) (acc to aGc)HP assay primer complementary to gyrA95 TRHPGyrA95ccctgggccatccgcaccaggg
HP assay primer complementary to gyrA95 SRHPGyrAT95Sgcctgggccatccgcaccaggc
HP assay forward primerFGyrA95cgagaccatgggcaactaccacc
  • a MB, molecular beacon.

  • b Capital letters indicate molecular beacon stem sequences; lowercase letters indicate the probe region. FAM, 6-carboxyfluorescein; DABCYL, 4{[4′-(dimethylamino)phenyl]azo}benzoic acid; TET, tetrachloro-6-carboxy fluorescein.