TABLE 2.

Primers used in this study for SCCmec element amplification and sequencing

IsolatePrimer pairNucleotide sequencegRestric- tion siteNucleotide coordinatesSCCmec region amplified
AR13.1/3330.2IRLII FCCCTCGAGGGCTCTGCGTATCAGTTAATGAXhoI4684-4703aL-Cc
ccrA RATTTGCGGCCGCGCTTCGATAGCCTGTTTCTGNotI25490-25471a
ccrA FACGCGTCGACCAAGTCATAGGCTATTTACGSalI25417-25436aC-Md (ccrA2-Tn554)
Tn554 RACGCGTCGACAAGCTATCCACGTTCAATCTCAACSalI32442-32419a
Tn554 FATTTGCGGCCGCCTTTAAAGGGTTTCGGAATANotI32365-32385aC-Md (Tn554-mecR1)
mecR1 RCCCTCGAGGGCAATGCCTAAACCTAATCGXhoI43754-43736a
mecR1 FATTTGCGGCCGCCGATTAGGTTTAGGCATTGNotI43736-43754aM-Ie (mecR1-ugpQ)
ugpQ RCCCTCGAGGGGCTTCTGCAGGATCTTGGXhoI47868-47851a
ugpQ FCCCTCGAGGGCCAAGATCCTGCAGAAGCXhoI47851-47878aI-Rf (ugpQ-dcs)
dcs RATTTGCGGCCGCCGGTCATGGCTATGATTTAGNotI56373-56354a
dcs FATTTGCGGCCGCGTCAATGAGATCATCTACATNotI56109-56128aI-Rf (dcs-right SCCmec junction)
orfX RATTTGCGGCCGCCCCAAGGGCAAAGCGACNotI57826-57810a
AR43/3330.1IRLII FCCCTCGAGGGCTCTGCGTATCAGTTAATGAXhoI4684-4703aL-Cc
ccrA RATTTGCGGCCGCGCTTCGATAGCCTGTTTCTGNotI25490-25471a
ccrA FATTTGCGGCCGCCAAGTCATAGGCTATTTACGNotI9894-9913bC-Md (ccrA2-mecA)
mecA RACGCGTCGACCCTATCTCATATGCTGSalI18160-18145b
mecA FATTTGCGGCCGCGATTGGGATCATAGCGTCATNotI18021-18040bM-Ie (mecA-IS431mec)
ISmec RACGCGTCGACACGGTGATCTTGCTCAATGASalI22780-22761b
ISmec FCCCTCGAGGGCCTGACTGTCATTGTACXhoI22724-22740bI-Rf (IS431mec-right SCCmec junction)
orfX RATTTGCGGCCGCCCCAAGGGCAAAGCGACNotI25395-25379b
  • a Nucleotide coordinates from SCCmec type II, accession number D86934.

  • b Nucleotide coordinates form SCCmec type IVa, accession number AB063172.

  • c L-C, the region from the left chromosome-SCCmec junction to the beginning of the ccr complex.

  • d C-M, the region from the ccr complex to the mec complex.

  • e M-I, the region from the mec complex region to IS431mec.

  • f I-R, the region from IS431mec to the right extremity of SCCmec.

  • g Text in bold indicates primer sequences, text in italics indicates restriction sites added to primer sequences, and plain text indicates extra bases added to aid with cloning.