TABLE 2.

Primers used in this study

Primer nameExperimentNucleotide sequence (5′-3′)LocationPositiona
PER.APCRATGAATGTCATTATAAAAGC bla PER-1 1
PER.DPCRAATTTGGGCTTAGGGCAGAA bla PER-1 2
PER.extAPCR and cloningCCTGCAACAGTACCTGCTTGISPa123
PER.extDPCR and cloningAACTGATAAGGTTGCCCTGC gst 4
PER.5′ext.1TAIL-PCR and 5′-RACEACTGCAACGCCTACAGTGGC bla PER-1 5
PER.5′ext.2TAIL-PCR and 5′-RACETGACTATGGATTCAATTTGCTC bla PER-1 6
PER.5′ext.3TAIL-PCR and 5′-RACEGGATTGCGCTGAGGTTTCG bla PER-1 7
ISPa12.BPCRGATCTCGCTTTACATTTACC tnpA of ISPa128
ISPa12.APCR and TAIL-PCRACAATCGCTGATATACATCG tnpA of ISPa129
ISPa13.BPCR and TAIL-PCRGGTATCCACCACATATGGGC tnpA of ISPa1310
ISPa13.APCRTAACCATATGCACTCAACGG tnpA of ISPa1311
ISPa14.APCRAATCAAATGTCCAACCTGCC tnpA of ISPa1412
ISPa14.BPCRGCCTAATTCGATGCCTTAT tnpA of ISPa1413
ISPrst1.APCRATTTCTGGAACTTTAACGAC tnpA of ISPrst114
ISPrst1.BPCRGACAGTCATTTTTTCAAGGC tnpA of ISPrst115
5′-CSPCRGGCATCCAAGCAGCAAG5′-CS, class 1 integron
3′-CSPCRAAGCAGACTTGACCTGA3′-CS, class 1 integron
AAP5′-RACEGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIGb
AUAP5′-RACEGGCCACGCGTCGACTAGTAC
  • a Position of the primers indicated in Fig. 1.

  • b I, deoxyinosine.