TABLE 2.

Primers used in this study

Primer nameExperimentNucleotide sequence (5′-3′)LocationPositiona
PER.APCRATGAATGTCATTATAAAAGCblaPER-11
PER.DPCRAATTTGGGCTTAGGGCAGAAblaPER-12
PER.extAPCR and cloningCCTGCAACAGTACCTGCTTGISPa123
PER.extDPCR and cloningAACTGATAAGGTTGCCCTGCgst4
PER.5′ext.1TAIL-PCR and 5′-RACEACTGCAACGCCTACAGTGGCblaPER-15
PER.5′ext.2TAIL-PCR and 5′-RACETGACTATGGATTCAATTTGCTCblaPER-16
PER.5′ext.3TAIL-PCR and 5′-RACEGGATTGCGCTGAGGTTTCGblaPER-17
ISPa12.BPCRGATCTCGCTTTACATTTACCtnpA of ISPa128
ISPa12.APCR and TAIL-PCRACAATCGCTGATATACATCGtnpA of ISPa129
ISPa13.BPCR and TAIL-PCRGGTATCCACCACATATGGGCtnpA of ISPa1310
ISPa13.APCRTAACCATATGCACTCAACGGtnpA of ISPa1311
ISPa14.APCRAATCAAATGTCCAACCTGCCtnpA of ISPa1412
ISPa14.BPCRGCCTAATTCGATGCCTTATtnpA of ISPa1413
ISPrst1.APCRATTTCTGGAACTTTAACGACtnpA of ISPrst114
ISPrst1.BPCRGACAGTCATTTTTTCAAGGCtnpA of ISPrst115
5′-CSPCRGGCATCCAAGCAGCAAG5′-CS, class 1 integron
3′-CSPCRAAGCAGACTTGACCTGA3′-CS, class 1 integron
AAP5′-RACEGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIGb
AUAP5′-RACEGGCCACGCGTCGACTAGTAC
  • a Position of the primers indicated in Fig. 1.

  • b I, deoxyinosine.