TABLE 2.

Primers and probes used in this study

Primer/probe nameSequence (5′ to 3′)b5′ Restriction siteaExpected size of product (bp)
Tet MF1CCGGAATTCCTGGGATTTTTATGCCCTTTTGEcoRI
Tet MR1CCGGAATTCTCCTTTCCACTTTAATTCAAATCEcoRI2,053
MepAF1CCGGAATTCGCTAATTATTGGAAAAGACAAGGEcoRI
MepAR1CCGGAATTCATATACTCAGCCAGAAGTGTACEcoRI1,419
MepRF1CCCGAGCTCTAGACATCTAACGAAATGGTGGSacI
MepRR1CCCGAGCTCCAGTCACACTTACCATTTATTGSacI466
pTet MF2CTCGCAATTTGAGTTGATATTAGNA
pTet MR1TTCATGTGATTTTCCTCCATTCNA436
pMepRF1TTGAAACAGGATCGGTTGTTTCNA
pMepRR1CCATTTATTGCACCACCATTTCNA534
MepRF2CAATAAATGGAATTCACTTATTCGNA
MepRR2CTTTCATTGTTCAATACTCCTTGNA539
RT-PCR MepA fwdTTATGGAAACTTCGCGATTGCNA
RT-PCR MepA revAACACCTTCACATAATCCCATGATAATNA91
RT-PCR MepA probeAGTTATGGTATCTCATTTAGACTTGTGCAATTTCCAGAANA
RT-PCR Tet M fwdAATGGGCTTAGTGTTTGTTTAGCANA
RT-PCR Tet M revCGGGTCTGGCAAACAGGTTNA74
RT-PCR Tet M probeAGCTAAAAGGATATCAGGTTACCACTGGCNA
RT-PCR 16SrRNA fwdCCAGCAGCCGCGGTAATNA
RT-PCR 16SrRNA revCGCGCTTTACGCCCAATANA62
RT-PCR 16SrRNA probeCGTAGGTGGCAAGCGTTATCCGGANA
  • a NA, not applicable.

  • b Restriction sites are underlined.