TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)Note(s)
0714FCAAAGCCAACGAGTTGTTCA3-kb product, SACOL0714 to SACOL0717
0717RCTTATTATAACGTTGAAGCTGC
1694FTCGACTTGATAAAGCACCTCAA2.2-kb product, SACOL1694
1694RAGTCCAAAGGACATCGCATT
2314FTCAAAGCTTAACATAGTCCG1-kb product, SACOL2314
2314RGTAACCTTACTGGTCTTATGG
2600FAGGTTCATTAGGTATGGGCG1.3-kb product, SACOL2600
2600RATTTCTCAAGGATAGGTC
IGFCGGTCATGTAGCATTTGTTGA582-bp product, intergenic region
IGRTGGAGCTGTATTGAGCACGGC
insertFGCCAAGCTTCAAAGCCAACGAGTTGTTCATo generate an insert for cloning into pCU1
insertRGCCAAGCTTCTTATTATAACGTTGAAGCTGCTo generate an insert for cloning into pCU1
DAP1367_attB1GGGGACAAGTTTGTACAAAAAAGCAGGCTTTGAAATTTTAAAACATTTGCTo generate an insert for cloning into pKOR1
DAP1365_attB2GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTATAACGTTGAAGCTGCTo generate an insert for cloning into pKOR1
DAP852CAAAGCCAACGAGTTGTTCATo confirm the generation of the graRS knockout of JKD6196 and the allelic exchange in JKD6208
DAP1436CGACTTGTGAGCCTTCCTTTATo confirm the generation of the graRS knockout of JKD6196 and the allelic exchange in JKD6208