TABLE 1.

Oligonucleotide primers employed for PCR detection of the novel type of SCCmec

Primer for identification of type 5C1 SCCmecNucleotide sequence (5′→3′)Nucleotide positionaExpected size of product (kbp)
mN13ACAACTTGCGAATTATGACGA6132-61521.9
γRCCTTTATAGACTGGATTATTCAAAATAT8071-8044
mN25TCCGCTTGTACAATTAATATTGAGCGT14310-143362.5
mN26ACGAAACGACCATGTCTGCTCTAACA16848-16823
mA2AACGTTGTAACCACCCCAAGA21149-211693.5
mS8CAAAATTGAGCGGAATCGTT24693-24674
mS6TGTTTTCGAGTATCGCTTTGA26080-261001.8
mS7GAAAGTGCGTTTATATCTGCAAAA27870-27847
  • a Nucleotide positions based on the nucleotide sequence in the DDBJ/EMBL/GenBank database (accession no. AB373032) are indicated.