TABLE 3.

Primers used for amplification and sequencing

LocusPrimer nameSequence (5′→3′)PositionaSource or reference
incL/MIncFCCCAAAGATGCAAAAAGAATG270 to 290This study
IncRAAAGACCTTCTACTGACTCAA749 to 729
blaTEM-1A216ATAAAATTCTTGAAGACGAAA−5 to 2011
A217GACAGTTACCAATGCTTAATCA1074 to 1053
tnpIS6IS6revACAGAATGATGTCACGCTG109 to 91This study
IS6forTGCACTACGCAAAGGCCAG681 to 699
  • a The coordinates refer to the replicon of pMU407.1 (GenBank accession number U27345), the Sutcliffe numbering of the blaTEM genes (22), and to the first base of IS6 (16).