TABLE 2.

Primers designed for sequencing of PBP4 genes

PrimerSequenceReference
EF PBP4 140′F5′CAACGAAAGCCTGATGAAATGG3′This study
EF PBP4 1043F5′CGATTGACAGTGTACAACAACAAGC3′This study
EF PBP4 1132R5′AATCGCCTTTTTGAGGATCGG3′This study
EF PBP4 2130R5′CGCTTCATTGTAGCACACTTTCCTTTTTC3′4