TABLE 2.

Primers used in this study

PrimerSequence (5′→3′)Product sizeaAccession no.b
MexCF1GCTGTTCCAGATCGATCCG160U57969
MexCRTRGGTATCGAAGTCCTGCTGG
PAERUGFTTACTACAAGGTCGGCGACATGACC267X54719
PAERUGRGGCATTGGGATAGTTGCGGTTG
OprDRTFCTACGCAATCACCGATAACC189Z14065
PAOpDR2GTGGTGTTGCTGATGTCGC
RpsLF1GCAACTATCAACCAGCTGGTG230AE004842
RpsLR1GCTGTGCTCTTGCAGGTTGTG
  • a Size of PCR products (bp).

  • b Accession numbers for GenBank.