TABLE 1.

Oligonucleotide sequences used in this study

Primer nameSequence (5′-3′)Reference or source
125′CSTTTTTGTGCTGCCATATCCGTGThis work
23′CSTGGGCTGAGAGAGTGGTThis work
satFTGAGCAGGTGGCGGAAACThis work
satRTCATCCTGTGCTCCCGAGThis work
dhfR1AGCTGTTCACCTTTGGC 10
dhfR1RCCTGAAATCCCCAGCAAThis work
aadA1TCGATGACGCCAACTAC 10
catB2RAACAAAGAAAAGGCATTGCThis work
catB2FCTGACTGAGCAGGTGAAGThis work
aadBFGTAACACGCAAGCACGATGAThis work
aadBRGCCTGTAGGACTCTATGTGCThis work
glmsFGGCGGTCAGTTGTATGTCTT 6
Tn75′RGACTCGTCCCGTCTTATGAG 6
tnsERTCGATTTGCTGCTTTTGATGThis work
tnsEFFTTGCTCTCTAACCACTCTThis work
tnsDRCCGTCTAATTTGATAATCTTCThis work
tnsDFGGGATTGTTAGTCCTAAGCThis work
tnsCRGCTATCCCAGTCGCTGGGThis work
tnsCFGTTTATCGTGATACGGGGGThis work
tnsBRGAGCAAGCATTTACAAAAGCThis work
tnsBFCATGTGGTCCAAGAACATAAGThis work
tnsARGCTAACAGTACAAGAAGTTCCThis work
tnsAFCTCCATATTCACTACTTGGCTThis work