TABLE 1.

Oligonucleotide primer pairs used

GenePrimerReferenceProduct size (bp)
DesignationSequence (5′-3′)
orf1 a ORF1TGATGAAGAGGAAAATTAG 21 266
ORF1RTACATCAACATTACCATCTG 1
orf1-orf2 a ORF1TGATGAAGAGGAAAATTAG 21 1,066
ORF2RGATTGATGTTCCTGATGC 21
orf2-orf3 a ORF2GCATCAGGAACATCAATC 21 1,119
ORF3RGACCTACCTGAACAATACC 21
orf3-mef(A)aORF3GGTATTGTTCAGGTAGGTC 21 1,050
OM18TGCTTGCCCTGCCCATATT 10
mef(A)aMEFA1AGTATCATTAATCACTAGTGC 39 348
MEFA2TTCTTCTGGTACTAAAAGTGG 39
mef(A)aMEF3GCGTTTAAGATAAGCTGGCA 10 1,743
MEF4CCTGCACCATTTGCTCCTAC 10
mef(A)-msr(D)aMF4ARTTCTTTGCTGATAAAATCGGTGT 21 440
ORF5F-RGGCAAGTTCACCCAGATG 21
msr(D)aMSRD1TGCCTATATTCCCCAGTT 1 708
MSRD2TTAATTTCCGCACCGACTA 1
msr(D)-orf6aMSRD2FTAGTCGGTGCGGAAATTAA 1 893
ORF6RCTACCGCTACTCCAACATG 21
orf6-orf7 a ORF6CATGTTGGAGTAGCGGTAG 21 202
ORF7RCCAAGTCTGACCAAAGATTTC 21
orf7-orf8 a ORF7GAAATCTTTGGTCAGACTTGG 21 297
ORF8RCGCTGGTGGATTGGAGGG 21
celB CELB1GAGAAAGTATTTTCTACGGGATGT 37 430
CELB2CCATACAGAACTAGGGTATCATCGTG 37
orf9-mef MEFA2TTCTTCTGGTACTAAAAGTGG 39 1,795
SG3GAATCTTTAGCCAGCGGTATC 11
int INT1GCGTGATTGTATCTCACT 31 1,046
INT2GACGCTCCTGTTGCTTCT 31
xis XIS1AAGCAGACTGACATTCCTA 1 194
XIS2GCGTCCAATGTATCTATAA 1
tet(K)TETK1TATTTTGGCTTTGTATTCTTTCAT 42 1,159
TETK2GCTATACCTGTTCCCTCTGATAA 42
tet(L)TETL1ATAAATTGTTTCGGGTCGGTAAT 42 1,077
TETL2AACCAGCCAACTAATGACAATGAT 42
tet(M)TETM3GAACTCGAACAAGAGGAAAGC 30 740
TETM4ATGGAAGCCCAGAAAGGAT 30
tet(O)TETO1AACTTAGGCATTCTGGCTCAC 30 2,002
TETO3TGCTCCCACAAACAGGACACAATATC 4
  • a Designed from the reported sequence of Tn1207.1 (38) (GenBank accession no. AF227520 ). However, the primers specific for the last five ORFs of Tn1207.1 are also applicable to the corresponding ORFs of the mega-element (13).