TABLE 2.

Oligonucleotides used in PCR and qRT-PCR

GenePrimerSequence (5′→3′)PositionaSize (bp)
rpoB rpoB RevATGCCGCCTGAAAAAGTAAC1960-1979154
rpoB ForTCCGCACGTAAAGTAGGAAC2114-2095
adeA adeA ForATCGCTAACAAAGGCTTGAA1024-1043159
adeA RevCGCCCCCTCAGCTATAGAA1183-1163
adeB adeB ForCTTGCATTTACGTGTGGTGT2907-2926168
adeB RevGCTTTTCTACTGCACCCAAA3075-3056
adeC adeC ForTACACATGCGCATATTGGTG1157-1176117
adeC RevCGTAAAATAACTATCCACTCC1274-1244
adeI adeI ForCAAATGCAAATGTAGATCTTGG511-532210
adeI revAAACTGCCTTTACTTAGTTG702-721
adeJ adeJ ForGGTCATTAATATCTTTGGC1142-1160221
adeJ RevGGTACGAATACCGCTGTCA1363-1345
adeK adeK ForTTGATAGTTACTTGACTGTTC1264-1285162
adeK RevGGTTGGTGAACCACTGTATC1407-1426
ampC ampC ForCAGTAATTCAGAACAGATTGTG927-947183
ampC RevGCGCTCTTCATTTGGAATAC1110-1091
adeS adeS ForTATGAAAAGTAAGTTAGGAAT1-191,072
adeS RevTTAGTTATTCATAGAAATTTT1073-1053
adeR adeR ForAATGCTTAATACACTGACTTTAGCCGGTGG−265-−2361,429
adeR RevTCTAGCAGAGAGGTCGC1101-1084
ISAba1ISAba1abATGCAGCGCTTCTTTGCAGG462-471379
ISAba1bbAATGATTGGTGACAATGAAG822-841
ISAba4ISAba4acATTTGAACCCATCTATTGGC140-159611
ISAba4bcACTCTCATATTTTTTCTTGG751-732
bla OXA-23 oxa23+ATGAATAAATATTTTACTTG1-20821
oxa23−TTAAATAATATTCAGCTGTT822-803
tniA tniA ForCAATGTGGTTGTCGGTTATGA54-74162
tniA RevATTCAAACTCTCAGTTAGCGT216-196
ATPaseATPase3′AATGGCGGTACATCAATATGT1215-1195492
ATPase5′GAAACTCTTGAAGTTGCAAGT723-743
  • a Coordinates refer to the first base of each gene.

  • b From reference 20.

  • c From reference 8.