TABLE 2.

Primers used in this study

PrimerSequence (5′ to 3′)Description
Km1-I outGAGCTCGAATTCGGCCTAGFor identification of transposon-inserted gene
Km1-O outCCTGCAGGCATGCAAGCTTCFor identification of transposon-inserted gene
Real-time-pmrIFCACGTCCAGTGGCAGATAACFor real-time PCR; paired with Real-time-pmrIR
Real-time-pmrIRCCCCATTTCAGTGGCTAAACPaired with Real-time-pmrIF
pmrI-F1GCGTCCTCGGTATTTTATCCFor complementation and PpmrI full-length sequencing; paired with pmrI-R
pmrI-RACATCGACTCTCAAGCCAACPaired with pmrI-F1
pmrI-R1CACATACCGTATACTTCTGATGFor PpmrI full-length sequencing
pmr-promoter-FCAACAATCGTTAGCTTTGCCFor reporter assay; paired with pmr-promoter-R
pmr-promoter-RGGAGAATGGAAGAAAGTGACPaired with pmr-promoter-F
pmr-promoter-F2TTGTCTACAAGGTGGCAGTAFor EMSA; paired with pmr-promoter-R
pmrI-upFATCGCGGTAGTGCAATTAAGFor PpmrI knockout; paired with Xba-pmrI-upR
Xba-pmrI-upRTCTAGACCAACACAGCCAATATCATGPaired with pmrI-upF
Xba-pmrI-downFTCTAGATATCGAAACACGCCAAACGGFor PpmrI knockout; paired with pmrI-downR1
pmrI-downR1TTCCCCGACAATCACTATTGPaired with Xba-pmrI-downF
RppA-F EcoRICGGAATTCATGAATATTTTATTAGTTGAFor His-tagged RppA expression; paired with RppA-R XhoI
RppA-R XhoICCGCTCGAGAAGAGCGGATCTTCATTTAGPaired with RppA-F EcoRI