TABLE 1.

Nucleotide sequences at the starts of plasmid-mediated qnrB, qnrA, and qnrS alleles

AlleleSequenceaGenBank accession no.
1↓2 ↓
qnrB1ATGACGCCATTACTGTATAAAAAAACAGGTACAA--AT-ATGGCTCTGGCDQ351241
qnrB2ATGACGCCATTACTGTATAAAAAAACAGGTACAA-AAT-ATGGCTCTGGCDQ351242
qnrB3ATGACGCCATTACTGTATAAAAAAACAGGTACAA--AT-ATGGCTCTGGCDQ303920
qntB4ATGTTGCAATCACTGTATAAAAAAACAGGT-TAATCATGATGACTCTGGCDQ303921
qnrB5ATGACGCCATTACTGTATAAAAACACAGGCATAG--AT-ATGACTCTGGCDQ303919
qnrA1CCGAAAGAGTTAGCACCCTCCCTGATTAAAGGAAGCCGTATGGATATTATAY070235
qnrS1ATAATGGTAGTCTAGCCCTCCTTTCAACAAGGAGTACTCATGGAAACCTAAB187515
  • a Potential initiation codons are indicated by arrows, and the essential components of a LexA binding site are shown in bold.