TABLE 1.

Primers used for characterization of the SCCmecC10682 element in this study

PrimerPrimer no.Sequence (5′ to 3′)Spanning position (bp)aProduct size (bp)aReference
ccr-FGGMGAACAAGTCARAAATGG25060-268281,769This study
ccr-RTTGCCTTGATAATAGCCTTCThis study
mecI-FCCCTTTTTATACAATCTCGTT5955-95893,63532
mecA147-RATGCGCTATAGATTGAAAGGAT32
J3-F201CTTCCTGTATTTCGTCTATGC835-1031197This study
J3-1R2TTTAAAAAATGATTATCCATCAGGThis study
J3-2F3CAACATCTAACTCCAACCAG2451-43601,910This study
J3-3R4TGTCTTTCTTACTTTAATATGACGGThis study
J3-1F5CCTTTAAATCTACTTTGTTCTGC5090-5234145This study
J3-R206AATACGATGATTTTATAGTAGGAGThis study
mecA17GTAGAAATGACTGAACGTCCGATAA7080-738931028
mecA28CCAATTCCACATTGTTTCGGTCTAA28
mecI-F9CCCTTTTTATACAATCTCGTT9444-958914632
mecI-R10ATATCATCTGCAGAATGGG32
J2-F2011AGAAGTCTTACACACTCCAGGC12144-12527384This study
J2-3R12TGATTGAGTGTTAAAGTTTCGThis study
J2-3F13GATGATAAATGCTCCACCTG13024-148401,817This study
J2-4R14CTTTATATCTTGATCGATTGCThis study
tnpB-F15AACGAGAGTGGAAATTGAAGC17462-198032,342This study
aad9-R16ACTTATCATCACACTCTCCCCGThis study
J2-F917CACACAGAAGCCATATTTAGCG21063-226181,556This study
tnpA-R18CTAAGCGATAACACTTCACCGThis study
J2-F619GATTTGTTAAATATTGTCGAGG22420-252612,842This study
J2-R920GATTTACAAGATATACAGCACCGThis study
ccr4-F21ATCGCTCATTATGGATACTGC25079-268281,750This study
ccr4B-R22CAATAGCACGTTGTCTTTGGCThis study
comp-F523GAATTTTTGAATGATACTGGC28303-301631,861This study
J1-R224AATGGATTGGAATAATACTAAGCCThis study
  • a Each primer size and spanning position apply to the forward primer and subsequently listed reverse primer.