TABLE 3.

Primers used for RT-PCR

PrimerDirectionSequence (5′→3′)
qnrB1ForwardGGTACAAATATGGCTCTGGCACTCG
ReverseGACAGCCGATAAATTCAGTGCCG
qnrB2ForwardCTCTGGCACTCGTTGGCGAA
ReverseAATTCAGTGCCGCTCAGGTCG
qnrB3ForwardCTCTGGCACTCGTTGGCGAA
ReverseAATTCAGTGCCGCTCAGGTCG
qnrB4ForwardTCAAAAGTTGTGATCTCTCCATGGC
ReverseAACTTGCGCCGCGAAAATCT
qnrA1ForwardTTTTCAGCAAGAGGATTTCTCACGC
ReverseGCTTTCAATGAAACTGCAATCCTCG
mdhForwardCTGCGTAACATCCAGGACACTAACG
ReverseCGACGGTTGGGGTATAAATAACAGG