TABLE 2.

Primers used in this study

PrimerSequence (5′-3′)a
Kana1GTGAATTGGAGTTCGTCTTG
Kana2TATGGACAGTTGCGGATGTA
ASP1GCTTCTCCAACTAAACCAAC
CRP2bCAAGACGAACTCCAATTCACATAAGAAGTAACCCGCCTTG
CRP3TACATCCGCAACTGTCCATAAAGCCTGTCTATCCATTAGG
ASP4TACTGAAAACCCTACGTACG
CRP5TACATCCGCAACTGTCCATAGCCCAGCTCTTTATTTAAGC
ASP6ACTTGTACCAAGGAGGATTTAG
pYF1TACATCCGCAACTGTCCATAGATTATCATAACTACATATTCCAT
pYF2GCTACTCAGTAAGCTTGCACT
pSU1ATATATACCATCATTGAATCGAGA
pSU2CAAGACGAACTCCAATTCACAAAACTATCGTCAATTCTGCAGA
Re1fwGGGGGGAATTCCATAAGAAAGAGTGATTATAT GG
Re2rvbGGGGGGAATTCACCTTCTATTGTAAGAAGGTACT
  • a The 5′ sequences of primers CRP2b and pSU2 (italics) are complementary to the Kana1 primer. The 5′ sequences of primers CRP3, CRP5, and pYF1 (italics) are complementary to the Kana2 primer. Primers Re1fw and Re2rvb contain EcoRI restriction sites (underlined).