TABLE 1.

Primer sequences used for PCR amplification and sequencing

GenePrimerSequence (5′ to 3′)Annealing temp (°C)Reference
16S rRNAapAAGAGTTTGATCCTGGCTCAG6211
pHAAGGAGGTGATCCAGCCGCA
sul1sul1bFCTTCGATGAGAGCCGGCGGC6329
sul1bRGCAAGGCGGAAACCCGCGCC
sul2sul2FTCGTCAACATAACCTCGGACAG60V. Enne
sul2RGTTGCGTTTGATACCGGCAC
sul3sul3FGAGCAAGATTTTTGGAATCG5118
sul3RCATCTGCAGCTAACCTAGGGCTTTGGA
intI1intAACAGGGCAAGCTTAGTAAAGCC6722
intBCTCGCTAGAACTTTTGGAAA
intI2int2FCACGGATATGCGACAAAAAGGT58.532
int2RGTAGCAAACGAGTGACGAAATG
qacEKazamF1GGGAATTCGCCCTACACAACAAATTGGGAGA5014
KazamR1TACTCGAGTTAGTGGGCACTTGCTTTGG
qacEΔ1KazamF2GGGAATTCGCCCTACACAACAAATTGGGAGA6014
KazamR2GCTGCAGCTGCGGTACCACTGCCACAA
  • a 16S rRNA gene sequence from bp 8 to 1522.